News

De ces deux théories, laquelle est vraie : le créationnisme, ou le darwinisme ? D'ailleurs, pourquoi faudrait-il choisir entre les deux ? Apparemment, nombreux sont ceux qui omettent la possibilité que ces deux théories soient fausses. 

Contrairement à ce que certains pourraient prétendre, tant le créationnisme que le darwinisme relèvent plus de l'idéologie que de la science, alors il n'est guère surprenant que ces deux théories - ou du moins, la façon dont on nous les présente - ne soient pas vraiment étayées par cette dernière. 

La plupart des tenants du créationnisme croient en cette théorie parce qu'ils ont été élevés dans le christianisme, et qu'ils croient en la Bible - un peu trop littéralement, d'ailleurs. Quant aux tenants du darwinisme, leur croyance semble reposer sur trois raisons : c'est ce qu'on leur a enseigné à l'école, ils n'ont qu'une vague idée des principes scientifiques qui le sous-tendent - ou, pour le coup, l'absence de tels principes, comme nous allons le voir -, et/ou ils sont convaincus que le créationnisme est une théorie inepte, et croient par conséquent que l'unique alternative qui s'offre à eux est le darwinisme. Or, ces trois justifications posent toutes sérieusement problème. 

Premièrement, la façon dont est enseigné le darwinisme à l'école est extrêmement trompeuse et mériterait à elle seule un article, mais je me contenterai de présenter dans les grandes lignes tout ce qui pose problème dans le darwinisme, et dans la façon dont on nous le présente. 

Deuxièmement, la plupart des gens n'ont qu'une connaissance très vague des vérités et faits scientifiques ayant trait à l'évolution, ce qui les empêche de distinguer les innombrables problèmes inhérents au darwinisme. L'idée selon laquelle les organismes auraient évolué par étapes est facile à avaler, quand on ne sait pas vraiment en quoi consistent ces supposées étapes ni comment les mécanismes de l'évolution sont censés opérer. Lorsqu'on ne sait pas vraiment à quoi ressemble une cellule, ce qu'elle contient, lorsqu'on ignore tout de sa complexité, de la façon dont elle opère et du rôle de l'ADN, tout ce qui reste, ce sont des arguments qui affirment que le darwinisme est parfaitement fondé et que la science est là pour le prouver - et que seuls les ignorants le mettent en doute. On entend rarement dire à quel point cette science est en réalité fragile, à quel point les preuves sont nébuleuses, et que nombre de scientifiques contestent cette version établie. Les idées anti-darwiniennes sont souvent littéralement bannies des salles de classe, généralement sur le principe fallacieux qu'elles ne sont pas scientifiques. Or le véritable raisonnement scientifique fait cruellement défaut au darwinisme lui-même. 

Troisièmement, le darwinisme et le créationnisme ne sont pas les seuls choix qui s'offrent à nous. Il ne s'agit pas d'une élection où vous devez choisir entre deux candidats. Lorsqu'on doit choisir entre deux candidats présidentiels et qu'on se laisse convaincre qu'il n'y a pas d'autre alternative, on a déjà perdu. Présumer que quiconque n'est pas darwiniste est automatiquement créationniste et vice versa est complètement fallacieux. 

Il y a le créationnisme, il y a le darwinisme, et il y a la vérité. C'est sur cette option trop souvent ignorée que je veux me concentrer dans cet article. Et pour découvrir la vérité, il nous faut identifier les mensonges. Je ne parlerai pas du créationnisme, car il repose sur un livre de fiction, et tente de faire coller les faits au récit biblique. En outre, peu importe les preuves apportées, les créationnistes resteront enferrés dans leurs convictions. Mon but est de montrer à ceux qui croient passivement que le darwinisme est la vérité mais qui n'ont jamais mené aucune recherche approfondie pour le confirmer ou l'infirmer, que cette théorie comporte d'énormes failles et que les identifier n'implique pas qu'on doive se tourner vers le créationnisme. 

Le fondement de ma réfutation du darwinisme est la science, en particulier les découvertes scientifiques de ces dernières décennies. Le darwinisme est resté bloqué à la première moitié du XXe siècle. Nul besoin d'invoquer Dieu pour démontrer que l'évolution darwinienne ne fonctionne pas telle qu'elle est décrite : la science s'en chargera. Croire en la capacité du darwinisme à expliquer l'évolution n'a rien à voir avec la quantité de vos connaissances, mais avec votre capacité à ignorer certains faits. 

Notons également qu'en général, nous parlons-là de choses qui sont rarement étayées par des preuves irréfutables, et les éléments probants dont nous disposons sont sujets à interprétation. Deux faits identiques seront interprétés différemment selon les personnes, et ces interprétations seront largement influencées par leur vision du monde et leurs croyances personnelles. Certaines choses sont incontestables, mais d'autres sont beaucoup plus nébuleuses. Par définition, toute théorie de l'évolution renvoie à des événements et des processus très anciens ; pour certains, nous ne disposons que d'éléments de preuve éparpillés qui n'incluent pas tout le contexte requis pour les comprendre pleinement. Dans de nombreux cas, nous devons nous contenter d'admettre que nous ne savons pas, et que nos croyances divergentes reposent sur des théories et des spéculations. 

Je diviserai cet article en trois grandes parties : en quoi consiste exactement le processus évolutif darwinien et quels sont ses mécanismes ; pourquoi il ne fonctionne pas, et ne peut pas fonctionner ; et enfin, ce que cela implique pour nous. 

Ce que dit vraiment la théorie darwinienne de l'évolution 
Le processus censé gouverner la théorie de l'évolution est la sélection naturelle, qui agit sur des mutations aléatoires. Les mutations aléatoires impliquent que des anomalies se produisent dans l'ADN. Les mutations aléatoires sont un processus naturel passif dont le rôle est simplement d'observer que tout ce qui survit suffisamment longtemps pour se reproduire parviendra à transmettre ses gènes. Les mutations aléatoires sont la force motrice qui fournit la matière première ; la sélection naturelle est censée organiser tout cela, en séparant le bon grain de l'ivraie. En réalité, non seulement la matière première produite de façon aléatoire est de qualité inférieure, comme on pourrait s'y attendre, mais le champ d'action de la sélection naturelle est bien plus restreint que ce que les darwinistes voudraient nous faire croire. 

Pour comprendre comment tout cela fonctionne, il nous faut examiner ce qui se passe à l'intérieur d'une cellule et voir en quoi consistent ces mutations. Essayez de répondre à ces questions : 
  • Quel est le niveau de complexité d'une cellule ?
  • Qu'est-ce que l'ADN et quelle est son action ?
  • Quelle est la relation entre l'ADN, un gène et un chromosome ?
  • Que sont les acides aminés et quelle est leur action ?
  • Que sont les protéines, d'où viennent-elles et quelle fonction servent-elles ?
  • Quand on parle de mutation, qu'est-ce qui mute, à quel endroit et de quelle façon ? Si vous croyez à l'évolution darwinienne et ignorez les réponses à ces questions, vous n'avez qu'une vague idée du processus censé gouverner l'évolution. Vous comprenez ses effets supposés, parce que c'est ce qu'on vous a appris, mais vous ne comprenez pas comment tout ceci fonctionne réellement au niveau moléculaire. Loin de moi l'idée de blâmer quiconque ignore ces choses-là. J'ai passé la plus grande partie de ma vie dans l'ignorance, moi aussi. Une fois qu'on comprend le fonctionnement et l'action de l'ADN et de tout ce qui l'entoure, la théorie darwinienne commence à s'effondrer sous le poids de sa propre invraisemblance. On s'écrit alors : « Attendez une minute ! C'est comme ça que fonctionne l'évolution ? ».Ainsi, permettez-moi de décrire dans les grandes lignes ce qui se passe à l'intérieur d'une cellule. Les paragraphes suivants risquent d'être un peu techniques. 
Vous avez probablement déjà vu une hélice d'ADN. Elle ressemble à une longue échelle torsadée sur elle-même. Les barreaux de l'échelle sont appelés paires de base. Il n'existe que quatre paires de base : A[denine], T[hymine], C[ytosine], et G[uanine. A est toujours apparié à T, et C est toujours apparié à G. Ça donne à peu près ça : 

A--T 
G--C 
C--G 
T--A 
C--G 
A--T 
A--T 
G--C 


Un très long brin d'ADN enroulé sur lui-même, qui peut contenir jusqu'à des centaines de millions de paires de base, forme un chromosome. Le noyau de chaque cellule humaine contient 46 chromosomes. Un gène est un fragment de chromosome. Entre autres choses, un gène est un ensemble d'instructions - une chaîne du code ATCG - pour synthétiser une protéine. Un chromosome peut contenir de cent à plusieurs milliers de gènes.

L'ARN est similaire à l'ADN, à ceci près qu'il ne contient qu'un seul brin - un côté de l'échelle -, et possède de nombreuses fonctions ; de nombreux éléments à l'intérieur de la cellule sont formés à partir de l'ARN. 

Les séquences codantes de type TCGATCACGTACAGGTCAGC sont similaires à notre code binaire informatique qui consiste en des séries de chiffres tels que 10010110101101001. Une série de 1 et de 0 pourra contenir des instructions sur la façon de lire un fichier vidéo ; une série de quatre lettres A, T, G et C contiendra des instructions pour le codage des protéines, parmi une foule d'autres choses. Les 46 chromosomes de chaque cellule humaine contiennent toutes les informations nécessaires à la formation et au bon fonctionnement du corps humain. 

Pour donner une idée de la complexité de la chose, je vais décrire dans les grandes lignes le processus de synthèse des protéines. Une enzyme s'apparie à l'ADN, le traverse - entièrement ou en partie - et copie l'un de ses brins, créant ainsi l'ARNm - ARN messager. Des séquences de lettres spécifiques indiquent où un gène commence et où il finit - un peu comme des en-têtes de fichiers informatiques. C''est ainsi qu'est créé l'ARNm, qui est plus ou moins la copie d'un gène. Tous ces processus sont en réalité bien plus complexes, mais je ne vais pas me lancer dans une explication sur les introns. Ensuite, un ribosome - lui-même formé à partir de l'ARN et de quelques protéines - s'apparie à l'ARNm et commence à le « lire », codon par codon. Un codon est un groupe de trois nucléotides, par exemple ACG. Un nucléotide est constitué de la base + la partie du squelette de l'ADN/ARN auquel il s'apparie. Pour notre propos, la différence entre une base et un nucléotide est infime. 

Pour chaque codon, le ribosome doit trouver l'ARNt porteur du bon anticodon. L'ARNt (ARN de transfert) est un petit fragment d'ARN ; à l'une de ses extrémités se trouve l'anticodon, et à l'autre extrémité, un acide aminé correspondant. L'anticodon est la séquence complémentaire d'un codon : ainsi, si l'ARNm contient CCC, l'ARNt doit contenir GGG pour pouvoir s'y apparier. Un ARNt possédant GGG portera toujours le même acide aminé. Les molécules d'ARNt flottent ça et là, et lorsque le ribosome trouve la bonne molécule, il s'y apparie, et son acide aminé est alors transmis au ribosome. Ensuite, l'ARNm passe au codon suivant du ribosome, lequel se met en quête du prochain ARNt et donc, du prochain acide aminé. Les acides aminés s'apparient et forment une longue chaîne - une protéine, d'une longueur comprise entre plusieurs dizaines et plusieurs milliers d'acides aminés. Ensuite, le champ d'action des protéines dans l'organisme sera multiple. 

Il n'est pas vraiment nécessaire de comprendre tout cela ; mon but est simplement de vous donner un aperçu de la complexité des processus constamment à l'œuvre dans chaque cellule. Mais il y a tellement plus. Une cellule est comme une ville au rythme trépidant, où tout un tas de choses se produisent simultanément, et il n'y a rien de simple là-dedans. Des choses sont transportées d'un endroit à un autre, d'autres choses sont fabriquées qui serviront à en fabriquer d'autres, et ainsi de suite. 


L'image ci-dessus représente une cellule unique - l'unité de base de la vie organique. Les plus petits éléments que l'on distingue ici, les ribosomes, sont des machines complexes qui jouent un rôle majeur dans la traduction des ARNm en protéines. Ce processus est extrêmement complexe. 

Comme l'explique John Sanford dans Genetic Entropy [Entropie génétique - Ouvrage non disponible en français - NdT] : « Un génome humain complet consiste en deux ensembles comprenant chacun 3 milliards de lettres individuelles. 

Outre de multiples formes d'informations génétiques qui se chevauchent, sont linéaires et sont apparentées à un langage, le génome regorge d'innombrables boucles et ramifications, comme un programme informatique. Il contient des gènes qui régulent d'autres gènes, lesquels en régulent d'autres. Il contient des gènes qui perçoivent des modifications dans l'environnement et ordonnent alors à d'autres gènes de réagir en mettant en mouvement toute une suite complexe d'événements qui pourront ensuite répondre au signaux environnementaux. Certains gènes se recombinent d'eux-mêmes, ou modifient et méthylent d'autres séquences de gènes, modifiant tout bonnement des passages entiers du manuel d'instruction ! » Les rouages internes d'une cellule sont incroyablement complexes, et les informations qu'elle contient (rappelez-vous que tous les chromosomes porteurs de la totalité de l'ADN se trouvent dans le noyau) défient l'entendement. Le code ATCG de l'ADN n'est que son élément le plus basique. Il y a des régions de contrôle, il y a l'enroulement de l'ADN, et de nombreux degrés de complexité au-delà du code lui-même. 

Maintenant que nous avons une idée de l'aspect du « code-maître » - celui qui construit tout - passons aux mutations aléatoires. Imaginons qu'en un locus spécifique de l'ADN, se trouve une paire de base A--T. Un processus de copie, en lisant A, commet une erreur quelconque : voilà la mutation. Ce qui se produit ensuite peut varier. Le A peut être transformé en n'importe laquelle des trois autres bases, ainsi au lieu de A--T vous aurez T--A, C--G, ou G--C. Autre option : le A sera omis/effacé, et cette suppression pourra concerner plusieurs paires de base. Il y a aussi l'insertion : une ou plusieurs bases sont insérées devant A à partir d'un autre locus, et notre A change de position dans la séquence. Il y a aussi la duplication, à savoir que A, ou même une séquence entière comme AACGCTTC, sera/seront copié/es une, deux, ou vingt-cinq fois. Bref, en essence, les mutations aléatoires sont les divers bugs susceptibles d'affecter le code ATCG dans l'ADN. 

Comme pour toute anomalie où qu'elle se produise, la plupart de ces bugs ne produiront rien de bénéfique. Prenons un fragment de gène ou d'ADN, du genre ACGTAGGCA : au cours de la traduction protéique, ce fragment sera divisé en ACG, TAG, et GCA, lesquels se mettront à coder pour trois acides aminés. Mais si quelque chose est inséré au début, par exemple G, vous aurez GACGTAGGCA, qui se scindera alors en GAC, GTA, et GGC, qui codera pour des acides aminés complètement différents de la séquence originelle, parce que la totalité de la séquence codante aura subi un glissement. Un glissement similaire peut se produire avec une seule suppression. Parce que ces séquences sont en essence fonctionnelles et très spécifiques, il est hautement improbable que toute erreur produise quoi que ce soit qui fonctionne mieux que l'original - en fait, ça pourrait bien ne pas fonctionner du tout. 

Le code génétique est quelque chose qui fonctionne très bien en l'état. Toute mutation aléatoire introduit des modifications aléatoires dans le code. À titre de comparaison : un livre est fonctionnel en l'état. Toute mutation aléatoire introduirait des modifications aléatoires au niveau des lettres du texte. Penser qu'on peut obtenir une nouvel organe fonctionnel dans l'organisme de façon aléatoire équivaudrait à introduire dans un livre un nouveau chapitre fonctionnel - intelligible - par ce biais. Pourtant, pour les darwinistes, c'est le mécanisme central de l'évolution de toute vie sur Terre ! Imaginons que le livre en question soit un manuel d'instruction pour construire un objet spécifique : quelles sont les chances que des modifications aléatoires introduites dans le manuel aboutissent à la fabrication d'un objet amélioré ? Vous comprenez certainement que les chances que cela se produise sont pratiquement nulles. Et comme nous le verrons plus loin, la sélection naturelle ne sera pas d'une grande aide. 

D'après le darwinisme, une bactérie a littéralement évolué par hasard pour aboutir à l'être humain, via l'accumulation d'erreurs de copie aléatoires dans son ADN. Contemplez un instant l'absurdité d'une telle idée. 

Est-il logique d'affirmer que le hasard crée un ordre fonctionnel complexe ? Quelque chose de fonctionnel, d'opérationnel, d'agissant, ne peut pas apparaître par hasard. Imaginez mélanger ou modifier certains des composants d'un appareil fonctionnel, comme un smartphone, pour aboutir à un fonctionnement amélioré. Il est clair qu'introduire des erreurs aléatoires n'est pas la façon d'améliorer un système fonctionnel. 

Les darwinistes croient qu'à ce stade, la sélection naturelle intervient pour tout arranger. Mais la sélection naturelle ne peut agir que sur quelque chose qui existe déjà, et ce qui existe déjà, ce sont des modifications aléatoires. Si le matériau de base de la sélection naturelle sont des modifications aléatoires de quelque chose qui fonctionne déjà, il n'y a guère de place pour la moindre amélioration. 

Chacun conviendra que le code génétique est plus sophistiqué et plus complexe que tout ce que les humains ont jamais pu concevoir. Dès lors, réfléchissez à cela : La conception intelligente de la technologie de pointe que nous possédons aujourd'hui, comme les super ordinateurs, requiert les cerveaux les plus brillants.

Pourtant d'après les darwinistes, quelque chose de bien plus complexe que tout ce que l'humain a jamais pu concevoir est généré par des erreurs aléatoires. Et quelles que soient vos connaissances à ce sujet, vous sous-estimez probablement grandement la complexité que cela implique. 

Voilà ce que nous dit Sanford à propos de l'ADN : Les preuves du caractère polyfonctionel et donc multi-restreint de la plupart des séquences ADN ne manquent pas. Ce fait a été amplement démontré par Trifonov (1989). Par exemple, la plupart des séquences codantes humaines encodent pour deux ARN différents qui lisent dans des directions opposées - à savoir, les deux brins d'ADN sont transcrits - Yelin et al. 2003. Certaines séquences encodent pour différentes protéines, selon le point d'initialisation de la traduction et du cadre de lecture - à savoir les protéines translectrices. Certaines séquences encodent pour différentes protéines selon l'épissage alternatif de l'ANRm. Certaines séquences servent de multiples fonctions simultanément - par exemple en tant que séquence de codage de protéine et que promoteur de transcription interne. Certaines séquences encodent pour une région codante protéique et une région de liaison protéique. Ainsi le même fragment d'ADN pourra coder pour plusieurs éléments différents, selon la façon dont il est lu et traduit. Même si l'introduction de modifications aléatoires dans la fonction d'une opération multifonctionnelle aboutissait par hasard à une fonction améliorée, cela détruirait indubitablement les autres fonctions. Le darwinisme est une théorie qui prétend que des obstacles insurmontables sont régulièrement surmontés, encore et encore, comme si c'était la chose la plus naturelle au monde. 

Laissez infuser cela, et plus vous y réfléchirez, plus le darwinisme vous apparaîtra comme la théorie la plus stupide jamais élaborée. 
Réfléchissez : pouvez-vous trouver dans notre monde un seul exemple d'une chose qui, par le biais d'un processus aléatoire, gagne en complexité et en fonctionnalité ? Les processus aléatoires peuvent au mieux générer des patterns intéressants, mais ceux-ci ne seront d'aucune utilité. On pourrait arguer que, peut-être, à de très rares occasions, un certain nombre de mutations aléatoires pourrait on ne sait comment s'accumuler et produire quelque chose de nouveau et de complexe. Admettons cette possibilité pour les besoins de notre argumentation - même si nous verrons que c'est qu'un fantasme, et ce pour de nombreuses raisons. Mais à votre avis, combien de complexes mutatoires de ce genre, chacun consistant en des dizaines ou des centaines de mutations individuelles, faudrait-il pour « transformer » un poisson en ours ? Des centaines ? Des milliers ? Et toutes les autres espèces devraient passer par le même processus. À chaque nouveau stade, la probabilité diminue par ordre de magnitude. Et pour que l'évolution fonctionne telle que décrite, ce phénomène devrait se produire continuellement. Des milliards de séquences d'événements de ce genre devraient se produire, alors même qu'une seule de ces séquences est hautement improbable, voire impossible. 

Si vous posez la question : « D'où vient ce foisonnement de vie ? », les créationnistes répondront « C'est l'œuvre de Dieu. » Les darwinistes trouvent cette explication faiblarde. Mais si vous leur posez la même question, ils répondront : « C'est arrivé par hasard. » Cette explication est encore plus faiblarde et irrationnelle. La vision darwinienne du fonctionnement des choses est extrêmement simpliste et naïve - tout comme le créationnisme. 

Le principe d'entropie affirme qu'avec le temps, tout se dégrade ; qu'à la complexité et à la singularité originelles succèdent la simplicité et la normalité, qu'à un état de probabilité moindre succède un état de probabilité supérieur, qu'à l'ordre succède le désordre. Mais la théorie de l'évolution contredit directement l'entropie. Pour la première, l'information contenue dans le génome devient naturellement et progressivement de plus en plus complexe, par un processus aléatoire, sans apport intelligent. Cette affirmation est illogique et insensée. Les informations porteuses de sens n'apparaissent pas aléatoirement, et la conscience ne surgit pas spontanément à partir de matière inerte. C'est pourtant là-dessus que s'appuie le darwinisme pour « fonctionner ». Il affirme qu'un processus aléatoire sans intelligence ni dessein produit de l'information, de la conscience et de l'intelligence. Le fait que vous lisiez ces lignes, que cela vous fasse réfléchir, est le résultat de l'assemblage aléatoire de molécules, il y a des éons de cela, et ces molécules ont produit des gènes fonctionnels, processus qui plus tard a abouti à votre existence et à celle de vos pensées - comme un effet secondaire complètement aléatoire ! Voilà le topo. Mais rien dans notre monde ne fonctionne de cette manière. Le produit fini dépendra toujours de l'apport initial. Si cet apport est un simple déchet aléatoire - mutation, erreur, le produit fini ne sera jamais quelque chose de fonctionnel et de plus complexe que l'original. 


De l'ADN au chromosome : selon les darwinistes, c'est le produit d'un auto-assemblage accidentel qui a évolué par un processus d'erreurs aléatoires. Néanmoins, il se trouve qu'il sait comment construire un être humain intelligent bien qu'aucune intelligence ne soit cependant impliqué dans le processus. Les choses « arrivent juste par hasard ». 

Les nombreuses lacunes du darwinisme 
Je commencerai cette partie avec un petit exemple. L'autre jour, je lisais Le plus grand spectacle du monde de Richard Dawkins. De tous ses ouvrages, c'est le seul qui contient une tentative d'explication du bien-fondé du darwinisme. Dans tous ses autres ouvrages, de son propre aveu, il part simplement du principe que le darwinisme est la vérité, et s'en tient là. Dans ce livre, il mentionne les expériences menées par Richard Lenski sur la bactérie E.Coli - Lenski cultive et étudie E.Coli depuis des décennies. C'est l'une des expériences concrètes les plus poussées sur l'« évolution ». 

Dawkins nous dit qu'un des groupes de cette bactérie a fini par développer une mutation A, qui par elle-même « ne faisait absolument rien ». Par la suite, A a évolué, pour donner la mutation B, qui, par elle-même ne faisait absolument rien non plus. Mais parce que la mutation A était déjà présente, les deux mutations ont fini par « agir en synergie ». Il a fallu des dizaines de milliers de générations pour en arriver à ce résultat. 

Selon Dawkins, cette expérience, c'est « l'évolution qui s'étend sous nos yeux », car elle nous montre que « de nouvelles informations peuvent pénétrer dans le génome », mettant à mal le dogme de la complexité irréductible. » Si vos seules sources d'information sur l'évolution sont vos manuels scolaires et les ouvrages de Dawkins, et que vous ne poussez pas la réflexion plus loin, vous ne verrez peut-être pas où est le problème. Or il y en a plusieurs, et voilà un bon résumé des habituelles distorsions darwiniennes : Dawkins ne nous dit absolument rien de la nature de A et de B et de leur action synergique. On ne sait pas vraiment de quoi il retourne.

Il omet de mentionner quelles « nouvelles informations » sont apparues et en quoi elles étaient vraiment nouvelles, par opposition à une simple modification des informations initiales.

Sa notion de la complexité se résume à deux parties.

Il ne nous dit pas comment la mutation A a pu franchir le cap de la sélection naturelle - alors qu'elle « ne faisait absolument rien » par elle-même - sans la mutation B.

Bien sûr, il ne lui viendrait pas à l'idée de se demander si le code génétique a pu être endommagé par ce qui s'est produit. C'est typique de Dawkins. Examinons cela plus en détail. 

1. Sans savoir où Dawkins veut en venir au juste, nous n'avons guère le choix que d'accepter son interprétation de ce qui s'est passé. Mais cela pose un sérieux problème. Les informations qu'il nous donne sont délibérément vagues, donc il est impossible de jauger de l'exactitude de son interprétation. Et c'est un élément-clé de la manipulation dont se rendent coupables tant les Dawkins de notre monde que nos systèmes éducatifs défaillants : on ne nous expose pas des faits ; on nous donne des interprétations de données présentées avec insistance comme des faits. Par opposition, si vous lisez les ouvrages de Michael J. Behe, qui expliquent pourquoi le darwinisme est incapable d'expliquer l'évolution, vous aurez droit à des explications extrêmement détaillées, qui vous permettront de comprendre très clairement de quoi il retourne, et vous serez bien mieux équipé pour décider si l'on vous ment. 

2. Vous aurez peut-être déduit de la lecture de la première partie de cet article qu'il n'y a pas vraiment moyen d'introduire de « nouvelles informations » dans le génome par le biais de mutations aléatoires. Tout n'est que modification de ce qui est déjà présent, et ces modifications sont bien plus susceptibles de détruire une chose que de l'améliorer. Dawkins nous dit que de nouvelles informations sont introduites dans le génome, mais nous n'avons aucune idée de ce qu'elles sont et donc, aucun moyen de savoir si cette affirmation est vraie. 

3. La complexité irréductible est expliquée en détail dans l'ouvrage de Behe, La boîte noire de Darwin. Pour résumer : si vous avez un système composé de vingt parties qui sont toutes nécessaires à son fonctionnement - supprimez une partie et le système devient inutile -, ce système ne pourra évoluer par étapes à la façon darwinienne, parce que cela impliquerait de passer par dix-neuf stades/états intermédiaires qui ne sont utiles à rien... par conséquent, la sélection naturelle ne les sélectionnerait pas. C'est l'un des problèmes majeurs du darwinisme. Dawkins crie « victoire » parce qu'il montre que quelque chose a évolué de sorte à développer deux parties qui se sont mises à agir en synergie. L'exemple de deux parties est littéralement le pire qu'on puisse trouver pour illustrer la « complexité », et pour couronner le tout, c'est tellement boiteux que ce n'est même pas drôle. 

4. On spécule que la mutation A ne faisait absolument rien par elle-même. Alors comment a-t-elle pu être sélectionnée par la sélection naturelle ? C'est l'élément-clé de l'évolution darwinienne. Si ça ne fait rien, si c'est inactif, ça n'est d'aucune utilité pour la survie et par conséquent, ça ne survivra pas. On s'attendrait alors à ce qu'on nous explique comment cette mutation s'est répandue dans le génome. Au lieu de cela, Dawkins ignore complètement cette question. Partant de là, comment prendre au sérieux tout ce qu'il peut raconter ? 

5. Quoi qu'il ait pu se produire lors des expériences de Lenski - nous n'en avons aucune idée, si l'on s'en tient au compte-rendu de Dawkins -, il est bien plus probable que, en parallèle à quelque chose qui aurait accru les chances de survie, une partie du code génétique se soit scindé. C'est plus crédible que d'affirmer que de « nouvelles informations » ont été introduites. Je reviendrai sur ces expériences plus loin. Mais Dawkins, comme la plupart des autres darwinistes, ignore également ce point. Il ne voit que ce qu'il veut bien voir et en tire une interprétation qui correspond à ses croyances préconçues. 

Malheureusement, nombre de gens lisent ses ouvrages sans avoir la moindre connaissance basique sur le sujet, et donc sont aisément convaincus par ses conclusions. Ils ne remarquent jamais toutes les manipulations, les incohérences, les idées fausses et les omissions, et pensent que Dawkins est un génie qui montre à ces imbéciles de chrétiens comment les choses fonctionnent. Les chrétiens peuvent certes avoir des idées imbéciles, mais malheureusement, les motivations de Dawkins sont tout autant idéologiques, ce qui en fait de facto un imbécile. 

Dans un chapitre précédent de son ouvrage, Dawkins parle de l'élevage canin et conclut : « Si tant de changements évolutifs peuvent se produire en seulement quelques siècles voire quelques décennies, pensez à ce qui pourrait être accompli en dix ou en cent millions d'années. ». Selon votre degré de perspicacité, vous aurez peut-être remarqué - ou pas - que l'élevage canin relève du dessein, et non du hasard. Vous aurez peut-être également remarqué que modifier les tailles, formes et couleurs de pelage des chiens n'aboutira qu'à des races de chiens différentes, mais jamais à des chats, des gorilles ou des aigles. Cela produira également des anomalies génétiques chez la plupart des espèces. Dawkins nous bombarde d'arguments bancals et d'extrapolations ridicules, tout en insistant constamment sur le caractère extraordinaire de l'évolution. 

Vers la fin de son ouvrage, Dawkins s'emploie à expliquer comment l'évolution combat l'entropie. Selon lui, la sélection naturelle est un système extraordinaire qui crée apparemment de nouvelles choses - donc qui combat l'entropie -, et si elle en est capable, c'est parce qu'elle est constamment alimentée par le Soleil ! Nous verrons plus loin jusqu'où s'étend réellement le champ d'action de la sélection naturelle, et le fait qu'elle ne « crée » rien. Ce que le Soleil a à voir là-dedans n'est pas clairement expliqué, à l'instar de tant d'autres affirmations de Dawkins. La seule chose qui puisse combattre l'entropie de l'information est la conscience/intelligence. La sélection naturelle peut, au mieux, ralentir l'entropie en éliminant les pires matériels génétiques, mais elle est incapable de l'inverser. 

Si vous voulez en savoir plus sur les erreurs, omissions et autres défauts de ce livre, consultez ce blog de David Swift, auteur de Evolution Under The Microscope [L'évolution scrutée au microscope - Ouvrage non disponible en français - NdT] . Il expose les nombreuses façons dont Dawkins induit le public en erreur. 

Dawkins ignore également la plupart des découvertes scientifiques du XXIe, voire de la fin du XXe siècle, ainsi que tous ces autres détails qui sont autant de vérités qui dérangent son argumentaire pro-évolution. Malheureusement, les gens avalent tout en bloc parce qu'ils n'ont pas les connaissances requises - Dawkins compte là-dessus. Souvent, ils veulent juste qu'on leur confirme dans un vocabulaire scientifique que le créationnisme a tout faux. Chaque aspect ou presque du darwinisme est a minima controversé - voire complètement inexact - pourtant Dawkins et les autres font comme si les preuves de l'évolution étaient tellement nombreuses que nous n'avons pas besoin d'en chercher plus, et quiconque fait preuve de scepticisme n'a qu'à lire ses ouvrages. 

Dawkins est l'incarnation de tout ce qui ne va pas dans la science actuelle en général et dans le darwinisme en particulier. Ses ouvrages sont fondés sur l'idéologie matérialiste, qui affirme que de la matière inerte accomplit des prouesses magiques à chaque instant. C'est un propagandiste et un manipulateur convaincant - à l'exemple des réchauffistes, il traite ceux qui ne croient pas à l'évolution darwinienne de « négationnistes » - qui répète sur un ton dogmatique que l'évolution est une réalité, qu'elle est extraordinaire, que tout est le fruit du hasard, que la sélection naturelle est ingénieuse - malgré un QI de 0 - et que rien n'a de sens... mais les « preuves » de toutes ces allégations sont purement imaginaires. Il donne dans la « science populaire », ce qui signifie qu'il n'y a rien de bien scientifique là-dedans, donc le profane aura du mal à juger de la véracité de ses dires. Tout n'est que fruit de sa propre interprétation faussée des données. 

Ce problème s'étend d'ailleurs à la façon dont le darwinisme est enseigné à l'école, où les élèves ont droit à une répétition ad nauseam du « fait » que l'évolution est une réalité - bien que les preuves sont soit inexistantes, soit falsifiées, comme nous allons le voir -, et l'omission délibérée des découvertes scientifiques de ces 50-70 dernières années met en exergue les problèmes sans cesse croissants que pose le darwinisme. 

L'ouvrage de Jonathan Wells, Icons of Evolution [Les icônes de l'évolution - Ouvrage non disponible en français - NdT], traite précisément de cette question. Il énumère un certain nombre d'« icônes » - des idées qui sont, encore aujourd'hui, présentées dans les manuels de biologie comme des preuves de l'évolution. Icônes qui, on le sait depuis longtemps déjà, sont trompeuses, inexactes, voire fabriquées de toutes pièces. Ce sont des choses que « tout le monde sait » parce que tout le monde est allé à l'école, sauf qu'elle s'avèrent fausses. Je vais en passer quelques-une en revue brièvement. Pour une explication plus détaillée, je recommande chaudement la lecture de l'ouvrage de Wells. 

 

Sur l'image ci-dessus figurent des dessins d'embryons de différentes espèces, montrant que les premiers stades de développement sont pratiquement tous identiques entre eux, quelle que soit l'espèce. Le hic, c'est que nulle part il n'est fait mention du fait que ces dessins ont été bidouillés. Outre le fait de sélectionner certaines espèces similaires entre elles - au détriment de la sélection d'autres espèces -, Haeckel, l'auteur de ces dessins, a choisi des stades intermédiaires de développement. Or au stade initial, les embryons se ressemblent moins, et plus important, Haeckel a délibérément modifié les dessins pour donner l'impression trompeuse que la ressemblance entre ces embryons était plus grande qu'elle ne l'est en réalité. Aujourd'hui, nous disposons de véritables photos d'embryons, et la similarité qu'on peut remarquer sur les dessins de Haeckel est tout simplement inexistante. 


Sur l'image ci-dessus, nous voyons une phalène du bouleau reposant sur un tronc d'arbre. Les phalènes sombres se voient mieux sur les troncs d'arbres clairs, tandis que les phalènes claires se voient mieux sur les troncs d'arbres sombres. On suppose que durant la révolution industrielle, alors que les troncs d'arbres se sont mis à foncer du fait de la pollution, les phalènes sombres sont devenues plus répandues parce que, leur couleur se confondant avec celle des troncs, cela leur permettait de mieux se camoufler, les protégeant ainsi de leurs prédateurs aviaires. Merci la sélection naturelle ! 

Par contre, ce qui n'est pas mentionné, c'est que la plupart des photos de phalènes sur des troncs d'arbres ont été bidouillées : les phalènes avaient été placées là par les photographes. Des expériences censées montrer la sélection naturelle à l'œuvre ont été conçues sans aucune rigueur scientifique, et il a fallu attendre des années pour que quelqu'un finisse par faire remarquer que les phalènes du bouleau ne se posent pas exclusivement sur des troncs d'arbres, à moins de les y déposer. Cela donna lieu à une polémique et toute l'affaire fut un fiasco, mais aujourd'hui, cette affirmation est toujours présentée dans les manuels scolaires comme une « preuve » de l'évolution. 


L'image ci-dessus présente un archæoptéryx, l'animal censé être l'intermédiaire entre les reptiles et les oiseaux. Le fait que la science ultérieure a montré que « l'archæoptéryx n'est pas l'ancêtre des oiseaux modernes - et ses propres ancêtres font l'objet d'une des controverses les plus vives de la science moderne » -, est complètement passé sous silence. 


L'image ci-dessus présente une mouche des fruits à quatre ailes, ce qui prouverait soi-disant qu'il est possible d'évoluer vers quelque chose de nouveau. La seconde paire d'ailes a été obtenue en laboratoire par des mutations ciblées. Toutefois, ce qui est passé sous silence, c'est que cette seconde paire d'ailes n'est pas fonctionnelle et qu'une combinaison de trois mutations spécifiques a été nécessaire pour l'obtenir ; cette expérimentation fut considérée, bien sûr, comme l'illustration d'une conception intelligente. Parce qu'un organe distinct a été utilisé pour les créer, les ailes n'ont pas seulement été ajoutées. Il se trouve que cet organe était important parce qu'il aide les mouches à maintenir leur équilibre. Et puisqu'une mouche est déjà dotée d'ailes, ces nouvelles ailes n'avaient rien de « nouveau » en soi, ce n'était qu'une paire d'ailes supplémentaire. Donc, ces mutants ont gagné des ailes supplémentaires non fonctionnelles qui ont entravé leur expression naturelle, ont perdu un organe qui leur était utile et n'ont survécu à l'intérieur du laboratoire que dans des conditions favorables. Dans la nature, ces mutants se seraient éteints parce que - devinez quoi - la sélection naturelle ne les aurait pas « sélectionnés » en raison de leur inutilité ! 

Il y a d'autres exemples, comme les pinsons de Darwin qui n'évoluent pas vraiment en quelque chose de différent, ou le raisonnement circulaire de l'évolution résultant en homologie et l'homologie prouvant l'évolution, mais nous nous arrêterons là. Le fait est que certains des exemples les plus connus de « preuve de l'évolution » sont faux, mais qu'ils sont toujours présentés aux étudiants sans mention de la controverse - au mieux - et de la fantaisie - au pire - qui les entourent. Donc, si vous faites partie de ces personnes qui croient que l'évolution est un fait prouvé parce que c'est ce qui est enseigné à l'école, mais que vous n'avez jamais fait de recherche personnelle à ce sujet, je vous recommande de lire Icons of Evolution pour voir à quel point l'évolution « prouvée » l'est vraiment. 

Et l'on pourrait aussi se demander pourquoi ces fausses preuves sont présentées dans les cursus scolaires s'il y a soi-disant tant de preuves claires et incontestables de l'évolution. Et lorsqu'un étudiant proteste, il s'entend répondre que la pensée critique n'inclut pas la remise en question de la science éprouvée de l'évolution. C'est littéralement le contraire de la pensée critique. À ce stade, on commence à avoir l'impression que quelque chose ne va pas dans ce tableau. Thomas Nagel a bien résumé le problème lorsqu'il a dit : « l'urgence politique de défendre l'enseignement scientifique contre les menaces de l'orthodoxie religieuse - aussi compréhensible soit-elle - a abouti à une contre-orthodoxie soutenue par de mauvais arguments et à une tendance à exagérer les revendications scientifiques légitimes de la théorie évolutionnaire. ». 

Alors qu'en est-il vraiment du darwinisme ? Est-ce que ça fonctionne ou pas ? La réponse à cette question n'est malheureusement pas un simple oui ou non. 

Supposons que Darwin ne savait pas de quoi il parlait lorsqu'il a proposé sa théorie pour la première fois en 1859. Ce n'est pas une tentative de le dénigrer ; je pense qu'il s'en est plutôt bien sorti, pour son temps. Mais voilà la mise en garde : « pour son temps » . À l'époque, la science pensait qu'une cellule était une goutte visqueuse, personne ne savait comment l'hérédité fonctionnait, et la découverte du code ADN se produirait dans un futur relativement lointain. Ainsi, bien que Darwin ait observé plutôt correctement la variation et la sélection naturelle, il ne savait pas d'où venait cette variation, et, comme tout le monde à l'époque, il imaginait que les choses étaient d'ordres de grandeur plus simples qu'elles ne le sont réellement. Le mot « imaginer » est très pertinent ici. La théorie de Darwin portait sur ce qu'il imaginait, mais il n'avait - et n'aurait pu avoir - aucune idée des limites du processus d'action de la sélection naturelle sur la variation. 

Plus tard, et avec la synthèse moderne des néo-darwinistes, les choses ont vraiment mal tournées. Ils avaient une meilleure idée de la façon dont les choses fonctionnaient, mais au lieu de se rendre compte des limites, ils se sont engagés dans une promotion quasi fanatique de la mutation aléatoire associée à la sélection naturelle comme l'explication à tout. Trop de dogmatisme enthousiaste, trop peu de science. Cela aurait pu être corrigé dans la seconde moitié du XXe siècle, mais au lieu de cela, le dogmatisme s'est renforcé et le darwinisme est devenu motivé par l'idéologie - étroitement liée au matérialisme et l'athéisme - plutôt que par la science. Par leur dogmatisme et leurs luttes vicieuses pour revendiquer la supériorité sur le créationnisme, les arguments en faveur de l'évolution sont devenus très semblables au créationnisme lui-même. Les darwinistes veulent prouver que Dieu n'existe pas et les créationnistes veulent prouver que Dieu existe, et les deux courants ignorent tous les faits qui ne correspondent pas à leurs thèses. Gagner le combat est devenu plus important que de découvrir la vérité. Entre-temps, la science a fait d'énormes progrès qui ont été ignorés ou déformés - à la manière de Dawkins - pour suggérer autre chose que ce qu'elle indique vraiment. 

En ce qui concerne ce que la mutation aléatoire associée à la sélection naturelle peut ou ne peut pas vraiment expliquer, les meilleurs travaux qu'il m'ait été donné de consulter sont ceux de Michael J. Behe. Dans ses livres The Edge of Evolution et Darwin Devolves [Les limites de l'évolution et L'involution de Darwin - Ces deux ouvrages ne sont pas disponibles en français - NdT], Behe démontre à l'aide de découvertes scientifiques récentes, que la mutation aléatoire associée à la sélection naturelle explique une certaine adaptation pour la survie, mais qu'elle ne peut rendre compte d'une évolution complexe. Plus spécifiquement, selon Behe, ce processus peut être observé au niveau des espèces et des genres, mais il ne parvient pas à produire quelque chose d'assez complexe pour créer une nouvelle famille ou quelque chose au-dessus [sous-ordre, ordre, classe ou phylum qui sont les catégories taxinomiques supérieures de la systématique - NdT]. La raison principale en est l'irréductible complexité qui dépasse de loin la capacité de la mutation aléatoire associée à la sélection naturelle, même théoriquement. Il y a plus de vingt ans, Behe a mis au défi la communauté scientifique d'expliquer comment un flagelle pouvait se manifester par le mécanisme darwinien de la mutation aléatoire associée à la sélection naturelle. À ce jour, personne n'a été en mesure de le faire ou de concilier le fait que les mutations qui dégradent le code génétique sont au moins mille fois plus rapides que celles qui pourraient l'améliorer - cette dernière étant au préalable très peu probable. 

C'est le cœur du problème pour le darwinisme. En principe, les mutations aléatoires et la sélection naturelle fonctionnent, comme décrit, mais ce processus est assez limité dans ce qu'il peut accomplir. C'est quelque chose que les darwinistes ne peuvent pas ou ne veulent pas comprendre. Ils utilisent la logique inverse de « si la facilité est possible, alors la difficulté doit être possible aussi ». Ils supposent que les mutations peuvent faire n'importe quoi, comme un drogué tellement shooté qu'il croit pouvoir voler. Mais elles ne peuvent pas. L'élevage canin ne créera jamais des chiens ailés. Ils n'ont pas le matériel génétique pour cela, et contrairement aux rêves des darwinistes, la sélection naturelle détruirait de toute façon un tel processus. Les darwinistes ont toujours confondu le changement de degré avec le changement de nature. 

Alors, de quoi avons-nous des preuves ? Dans les cas où l'on a prouvé l'évolution - mais plus précisément l'adaptation - entre un spécimen étudié et un autre, on observe surtout une dégradation du code génétique. Lorsqu'une amélioration apparente du code génétique entre deux spécimens est constatée, cela ne donne aucune preuve directe d'une réelle évolution. Les darwinistes le supposent simplement par défaut. 

Il existe des preuves de l'efficacité du processus de mutation aléatoire associée à la sélection naturelle - par exemple, l'adaptation du paludisme aux médicaments, l'expérience de Lenski sur E. Coli montrant que les bactéries peuvent, par exemple, augmenter l'efficacité de leur métabolisme, les cichlidés dans les lacs africains se diversifiant en plusieurs espèces, etc. Mais il y a clairement dans tous ces cas une limite au potentiel « évolutif ». Il s'agit plus d'une spécialisation - généralement au détriment de la polyvalence - que d'une évolution. 

Behe le décrit ainsi : « Le principe fondamental semble très probablement le suivant : des variations aléatoires mineures autour d'un schéma conçu sont possibles et peuvent être utiles, mais leur portée est très limitée. Pour les nouveaux modèles de base tels que ceux qui se situent au niveau biologique de la famille et au-delà [propre à la systématique - NdT], des informations supplémentaires sont nécessaires, des informations qui dépassent la capacité de production des processus inconscients. » Au cours des quelques décennies où nous les avons observés, le paludisme et le virus du VIH ont subi autant de mutations que les êtres humains dans toute leur histoire - parce qu'il sont nombreux et qu'ils ont une courte durée de vie générationnelle. Et quels résultats ont-ils obtenu ? Pas grand-chose. Ont-ils développer quelque chose de nouveau ? Non. Ont-ils changé d'une manière observable ? Non. Ils ne sont résistants qu'à quelques-uns de nos médicaments, ce qui n'implique habituellement qu'une seule mutation. Le virus est toujours un virus, et la bactérie est toujours une bactérie. Aucun changement dans leur nature, aucune nouvelle fonction. 

Quant à l'expérience E. Coli de Lenski, tous les progrès apparents n'ont pas été sans conséquences. 
« ... la bactérie s'est débarrassée à plusieurs reprises de morceaux de son patrimoine génétique, y compris la capacité de fabriquer certains des éléments constitutifs de l'ARN. Apparemment, se débarrasser de machines moléculaires sophistiquées au prix d'un grand sacrifice permet à la bactérie d'économiser son énergie. Rien d'aussi élégant - loin s'en faut - n'a été construit. [...] 

La bactérie s'est comportée en éprouvette comme les agents pathogènes à l'état naturel : de nombreux changements incohérents ont légèrement modifié les systèmes préexistants. Rien de fondamentalement nouveau n'a été produit. Pas de nouvelles interactions protéine-protéine, pas de nouvelles machines moléculaires. Comme dans le cas de la thalassémie chez l'homme, certains avantages évolutifs importants ont été conférés par la destruction de certains éléments. Plusieurs populations de bactéries ont perdu leur capacité de réparer l'ADN. » C'est le genre d'informations que l'on obtient des travaux de Behe, mais pas de ceux de Dawkins. Le résultat de l'évolution depuis des dizaines de milliers de générations, c'est que des éléments sont plutôt détruits et que rien de complexe, même de loin, n'est créé. La sélection naturelle sélectionne pour la survie dans les conditions qui lui sont propres. Elle ne se soucie de rien d'autre. Il n'y a pas de planification, pas de préoccupation pour la qualité globale du génome. 

C'est l'un des aspects les plus importants de la mutation aléatoire. Le code génétique tend bien plus à dégénérer qu'à se perfectionner, même au sein de mutations qui améliorent la survie. Un organisme stressé peut bidouiller une « solution aux effets secondaires imprévisibles » qui l'aidera, mais qui détruira un autre élément beaucoup plus vite qu'avec une solution constructive. Et si ce bidouillage assure la survie de l'organisme le temps qu'une solution constructive puisse être trouvée - tant est qu'il la trouve - cette dernière ne sera plus nécessaire, elle n'aura plus d'effet et la sélection naturelle n'y verra rien. C'est pourquoi les mutations bénéfiques - pour la survie immédiate - mais nuisibles - au code génétique - prévalent presque toujours. Ceci est expliqué en détail dans Darwin Devolves de Behe et dans Genetic Entropy de Sanford. 

Il est tout simplement logique qu'un processus inintelligent et aléatoire se conforme au principe de l'entropie. L'information diminue dans l'organisme, des parties du code génétique sont perdues et rien de nouveau n'est créé. S'il existe vraiment une innovation dans les organismes, elle doit venir d'ailleurs. 

Ainsi, l'évolution - mot qui signifie vraiment survivre en déchiffrant le code génétique - n'est un « fait prouvé » qu'à ce faible degré. Le reste n'est que spéculation, hypothèses et interprétation biaisées. La logique qui tend à penser que « si cela peut arriver dans vingt ans, imaginez ce qui peut arriver dans vingt millions d'années » est une erreur. C'est comme vouloir démontrer qu'en tournant un Rubik's cube pendant cinq minutes on obtiendra des motifs de couleurs intéressants, et puis prétendre que le cube pourrait devenir une voiture en continuant pendant cinq ans. Il y a des limites à ce qu'un processus spécifique peut accomplir. Les darwinistes insistent sur le fait que leur processus aléatoire est aussi omnipotent que le Dieu des créationnistes. 

Et la mutation aléatoire n'est pas la seule à présenter des limites, la sélection naturelle est également limitée et même limitante. Imaginons que cinq mille mutations sont nécessaires pour passer d'une espèce à une autre très différente et que ces mutations doivent être introduites de manière artificielle - une toutes les deux ou trois générations. La sélection naturelle agirait en fait à l'encontre de l'intention initiale, parce que 99 pour cent des mutations ne seraient d'aucune utilité en soi et qu'il n'y aurait donc aucun avantage pour la survie de l'espèce en question. Et comme nous l'avons vu, construire quelque chose qui n'est pas - encore - utile a des conséquences ; perdre des éléments plutôt que d'en gagner s'avère donc être la tendance dominante. La sélection naturelle est utile mais seulement pour des choses immédiatement bénéfiques à la survie. La plupart du temps, il ne s'agit que de mutations simples. 

Créer quelque chose de nouveau avec la mutation aléatoire est une lutte ardue même en association avec la sélection naturelle. Selon Genetic Entropy : « La nature extrêmement dommageable des mutations peut être constatée par l'incroyable rareté des cas évidents de mutations génératrices d'information. Il faut comprendre que les scientifiques disposent d'un réseau très sensible et très étendu pour détecter les mutations créatrices d'information, et que la plupart des généticiens les recherchent avec diligence en permanence. Cela est vrai depuis environ cent ans. La sensibilité de ce réseau d'observations est telle que même si une seule mutation sur un million créait sans ambiguïté de nouvelles informations - à l'exception des ajustements -, la littérature regorgerait de rapports à ce sujet. Pourtant, je ne suis toujours pas convaincu qu'il existe un seul exemple flagrant d'une mutation connue ayant sans ambiguïté créé de l'information. Il y a certainement beaucoup de mutations qui ont été décrites comme bénéfiques, mais la plupart de ces mutations bénéfiques n'ont pas créé de l'information, elles l'ont plutôt détruite. [...] 

Au cours du siècle dernier, beaucoup d'efforts ont été consacrés à essayer d'utiliser la mutation pour générer des variations utiles. C'était particulièrement vrai dans mon propre champ de recherches, la sélection végétale. Lorsqu'on a découvert que certaines formes de rayonnement et certains produits chimiques étaient de puissants agents mutagènes, des millions et des millions de plantes ont été mutagénisées et ont été triées afin de déterminer les améliorations possibles. [...] Pendant plusieurs décennies, c'était l'axe principal de la recherche sur l'amélioration des cultures. Un grand nombre de mutants ont été produits et triés, représentant collectivement plusieurs milliards de cas de mutation. Un grand nombre de petites plantes stériles, malades, déformées et aberrantes ont été produites. Cependant, tous ces efforts n'ont presque pas permis d'améliorer les récoltes de façon significative. L'effort a été un énorme échec dans son ensemble et a été presque entièrement abandonné. Pourquoi cette énorme expérience de mutation/sélection a-t-elle échoué alors que de nombreux scientifiques titulaires d'un doctorat y ont contribué tout ce temps ? Parce que même avec tous ces milliards de mutations, il n'y a pas eu de nouvelles mutations bénéfiques significatives. » Par conséquent, les mutations bénéfiques sont pratiquement inexistantes, mais de nombreuses mutations nuisibles échappent à la sélection naturelle, ce qui explique l'existence de choses comme les maladies génétiques. Les organismes dont l'ADN contient des erreurs dommageables peuvent encore survivre et se reproduire, et puisque ces erreurs surviennent infiniment plus souvent que tout ce qui est réellement bénéfique, le code génétique se détériore avec le temps. La grande majorité des mutations sont presque neutres et n'affectent donc pas la survie ; elles sont également invisibles pour la sélection naturelle mais introduisent constamment de plus en plus de petites erreurs dans le code génétique. C'est l'entropie en action. 

Gardez également à l'esprit que les mutations se produisent au niveau des nucléotides, tandis que la sélection naturelle se produit au niveau de l'organisme entier. Nous avons peut-être de nombreuses mutations dans notre corps, certaines bénéfiques, d'autres très dommageables, mais survivre assez longtemps en tant qu'un tout global en vue de nous reproduire est la seule chose qui compte du point de vue de la sélection naturelle. Il n'y a aucun moyen de démêler les différentes mutations. 

La puissance limitée de la sélection naturelle est d'autant plus évidente que l'organisme est grand. En fait, elle fonctionne mieux chez les bactéries et les virus où une seule mutation peut faire une différence visible. Mais chez les mammifères, une seule mutation - à moins qu'elle n'endommage un élément de façon très préjudiciable - sera dans presque tous les cas invisible, noyée dans des milliers d'autres caractéristiques, et n'entraînera aucun changement significatif du taux de survie. Et parce que les mutations dommageables sont des milliers de fois plus fréquentes que les mutations bénéfiques, l'état normal de tout organisme s'avère comporter des milliers de petites mutations délétères. Si une mutation bénéfique apparaît, elle ne peut survivre qu'en emmenant avec elle toutes ces mutations délétères. Les dommages globaux sont toujours plus importants que les avantages. À aucun moment un organisme n'aura plus de mutations bénéfiques que de mutations délétères. 

Les darwinistes considèrent presque la sélection naturelle comme un Dieu qui choisit ce qui survit ou pas avec la plus extrême précision. Mais il n'y a pas de précision. La « chance inouïe » a plus à voir avec la survie qu'avec la sélection naturelle. Comme le souligne Sanford, si une baleine avale quelques milliers de crevettes en une seule bouchée, avale-t-elle les moins en forme ? Non, c'est aléatoire. Si le saumon nage vers l'amont pour pondre des œufs et qu'un ours attend d'en attraper quelques-uns, quelles sont les chances que l'ours obtienne les spécimens les moins en forme ? À peu près aucune. Les cas pour lesquels le facteur sélection naturelle fait un choix sont minimes en regard d'un certain nombre d'autres facteurs. 

La sélection naturelle élimine principalement les organismes qui sont tellement endommagés qu'ils s'avèrent réellement incapables de suivre le rythme des autres. Les bactéries développant une résistance aux médicaments est l'un des rares exemples où la sélection naturelle « favorise quelque chose de nouveau ». C'est ici une circonstance lors de laquelle une différence significative peut être produite avec un effort minime, parce qu'il ne s'agit que d'une seule mutation dans un petit organisme. Encore une fois, dans un organisme plus grand, il est très peu probable qu'une seule mutation soit visible pour la sélection naturelle. Mais il n'y a pas de sélection pour les mutants. La sélection ne peut se faire que contre les non-mutants. La sélection ne fonctionne ici que parce que la drogue tue littéralement tous les non-mutants. La sélection naturelle n'a aucun pouvoir créatif. Elle ne peut que supprimer. Un élément nouveau qui s'avère utile survivra. Mais il en sera de même pour les organismes sains qui survivent depuis le début - à peu près au même rythme - à moins que les circonstances n'aient changé de façon significative. Pour l'essentiel, le travail de la sélection naturelle est d'essayer de préserver le code génétique tel qu'il est afin d'éviter qu'il ne se dégrade. Les mutations le dégradent tout le temps, mais la sélection naturelle ne peut supprimer que les pires d'entre elles. Si une mutation bénéfique apparaît, elle apparaît dans un organisme qui a déjà accumulé des centaines de petites mutations dommageables, donc même si l'organisme survit, le code continue de se dégrader. La seule chose que la sélection naturelle peut faire est de supprimer du patrimoine génétique les organismes qui ne peuvent se reproduire - quelle qu'en soit la raison. Il n'existe tout simplement aucun moyen de progression sur le long terme. Pas par ce processus en tout cas. 

Et gardez à l'esprit que même une simple bactérie nécessite des milliers de générations et des milliards de spécimens afin qu'une mutation particulièrement significative se manifeste. Les bactéries passent par ce processus très rapidement. Pour les mammifères, une telle mutation pourrait prendre un million d'années avant d'apparaître et dans la plupart des cas, la sélection naturelle ne la verrait même pas. 

À titre d'argument, supposons la naissance d'un loup qui peut courir deux fois plus vite que les autres loups. Il s'agit bien sûr d'une prouesse complètement irréaliste pour une mutation aléatoire, mais partons tout de même de cette hypothèse. Ce serait à peu près tout ce que l'on peut espérer qu'une mutation aléatoire puisse offrir à la sélection naturelle pour qu'elle puisse fonctionner. La question ici est de savoir ce que peut vraiment faire la sélection naturelle. Les darwinistes diront qu'elle « sélectionne pour la mutation aléatoire » et supposeront automatiquement que les loups en tant qu'espèce ont évolué ainsi pour devenir deux fois plus rapide. 

Mais c'est très naïf. Que se passe-t-il en réalité ? On peut supposer que ce loup n'aura aucun mal à attraper une proie. On peut même supposer qu'il mangera littéralement quand il le voudra - bien que cela ne soit pas nécessairement vrai en raison de la faible disponibilité des proies et autres circonstances. Mais que peut y faire la sélection naturelle ? Le loup survit, bien sûr, mais comment cela affecte-t-il les autres loups ? Ils peuvent toujours attraper leurs proies exactement au même rythme qu'auparavant. La sélection naturelle ne peut favoriser ce loup deux fois plus rapide qu'en éliminant les autres loups. Elle ne peut pas plus le faire se reproduire. Elle ne peut tuer d'autres loups que s'ils sont incapables de survivre. Mais la capacité de survie de ce nouveau loup n'a pas diminué la capacité de survie des autres loups. Loin s'en faut puisque lorsqu'ils chassent en meute et capturent une proie ils mangent tous. Dans ce cas, l'avantage est transféré à l'ensemble du groupe, mais l'ensemble du groupe ne transmet pas les gènes du nouveau loup. 

Voici pourquoi l'idée stupide de Dawkins sur les gènes égoïstes s'avère ne pas fonctionner : bien que ce loup deux fois plus rapide et sa progéniture puissent facilement survivre, on peut s'attendre à ce que leurs gènes se propagent à peine mieux que par simple dérive génétique. Nous sommes loin des « loups qui évoluent pour devenir plus rapides ». Et notez que ce loup est toujours - peut-être plus que les autres ! - sujet aux blessures, aux maladies, au froid, à la chasse humaine et à tous les autres périls qui pèsent sur les loups - peu importe qu'une telle mutation soit très susceptible d'endommager un autre élément de son génome de loup. Donc, même si une telle étape d'évolution aussi étonnante et improbable soit-elle s'est effectivement produite, une mort malchanceuse de ce loup demeure plus probable. Et cette malchance est généralement bien plus vraisemblable que la mutation elle-même. 

Le pouvoir étonnant de la sélection naturelle n'existe pas dans le monde réel tel qu'il existe dans l'imagination de Dawkins. Et que les bactéries unicellulaires - dans lesquelles la sélection naturelle est plus puissante que dans les organismes plus complexes - n'aient pas tellement évolué depuis deux milliards d'années, s'avère être ironique mais très révélateur. 

Ce qui nous amène à la fameuse explosion cambrienne, une autre des nombreuses problématiques du darwinisme. Pendant deux milliards d'années, seuls des organismes unicellulaires ont existé, sans que rien de complexe ne soit produit. C'est parfaitement sensé. Ce qui n'a aucun sens - du point de vue darwinien -, c'est que soudainement, en quelque vingt millions d'années, la plupart des phylums [embranchements ou divisions en systématique - NdT] du règne animal sont apparus dans toute leur complexité. Selon le pronostic darwinien, les choses évoluent lentement à un rythme assez constant. L'explosion cambrienne s'oppose totalement à cette théorie. Bien sûr, les darwinistes - qui commencent avec la croyance préformée que l'évolution est vraie et qui tentent ensuite de déformer les faits pour qu'ils correspondent à la conclusion - avancent toutes sortes d'excuses particulièrement boiteuses que nous n'aborderons même pas ici. 


L'évolution est lente et progressive. Comme... pas sur cette photo.Ce qu'il y a d'amusant à considérer, c'est que si quoique ce soit dans cette description est causé par des mutations aléatoires, il s'agit plus probablement du déclin des espèces plutôt que de leur création. La mutation aléatoire est plus susceptible de jouer un rôle dans l'extinction des espèces plutôt que dans leur évolution. L'ironie de ce fait est épique. 

Les darwinistes confondent également souvent « compatible avec » et « preuve à l'appui ». Chaque fois qu'ils observent un processus en cohérence avec l'évolution, ils affirment que c'est la preuve de l'évolution. Mis à part le fait qu'il s'agit là d'une erreur, il ne leur vient pas à l'esprit que cette « preuve » est en fait - dans 90 pour cent des cas - également conforme à la principale théorie concurrente - la conception intelligente. 

Ascendance commune 
L'ascendance commune n'est pas réellement prouvée. Ce n'est pas un fait ; c'est une interprétation d'un fait, le fait que différents organismes se ressemblent anatomiquement et sont donc vraisemblablement apparentés. Mais s'agit-il d'une ascendance commune ou d'un concepteur commun ? La similitude de conception de différents organismes est tout à fait logique du point de vue de la conception intelligente. Si l'on veut concevoir une nouvelle voiture, sera-t-elle conçue à partir de zéro, y compris en réinventant la roue ? Bien sûr que non. Une voiture semblable à celle envisagée servirait de modèle avant de choisir et d'effectuer les modifications qui feraient d'elle une nouvelle voiture. La similitude de l'anatomie n'est pas une preuve d'évolution, surtout lorsqu'elle correspond parfaitement à la théorie opposée. Bien sûr, c'est là que les darwinistes se ridiculisent tout seuls en déclarant comment Dieu concevrait ou non les choses. Étant des athées matérialistes qui nient l'existence de tout ce qui s'approche d'une idée divine, les darwinistes sont bien sûr les experts en chef sur ce que Dieu ferait ou ne ferait pas. 

Si l'on aligne une centaine de voitures différentes et qu'on invite un darwiniste d'une autre planète où il n'y a pas de voitures à regarder, il verra immédiatement l'ascendance commune de ces voitures, l'homologie, et la preuve évidente que ces voitures ont évolué d'un ancêtre unique et qu'il n'y a absolument aucun besoin de conception. Il sera en mesure d'aligner les voitures dans l'ordre dans lequel elles ont probablement évolué. Ce sont des preuves évidentes, non ? Personne n'a conçu les voitures. Cela peut sembler absurde, mais c'est vraiment une analogie assez fidèle de la façon dont les darwinistes « prouvent » l'ascendance commune. Bien sûr, la similitude de structure n'est pas non plus la preuve d'une conception commune ! C'est une simple ressemblance qui s'avère conforme aux deux théories et qui peut être interprétée de différentes façons - comme je l'ai précisé au début de cet article. Mais les darwinistes l'utilisent comme « preuve » de l'évolution, ce qui est une fausse preuve. 

L'être humain est un cas spécifique dans lequel je n'essaierai même pas d'entrer. Dans le contexte de l'évolution, l'humain est un sujet tellement controversé que les ouvrages qui lui sont consacré sont légion. La question de savoir comment les êtres humains ont « évolué » pour devenir ce qu'ils sont aujourd'hui implique de nombreux mystères que personne n'a été capable de résoudre de manière satisfaisante. Sauf pour les dommages génétiques tellement graves qu'un enfant puisse en mourir ou un adulte être stérile, la sélection naturelle ne fonctionne pas du tout dans le cas des êtres humains. Les gens plus intelligents se reproduisent-ils plus que les stupides ? Non. Les gens qui font de l'exercice se reproduisent-ils plus que les gens paresseux et obèses ? Non. 

Alors, que peuvent vraiment faire les mutations aléatoires et la sélection naturelle ? Jetons un coup d'œil. 

Un loup peut-il devenir un chien ou un renard ? Probablement. Si l'on peut même dire qu'il s'agit d'une évolution ; je dirais que c'est juste une adaptation à l'environnement. Ils ont la même structure squelettique, les mêmes organes, la même fourrure, le même nombre de pattes, etc. Seul un changement de taille et de couleur serait nécessaire. De simples mutations peuvent faire l'affaire. 

Un loup peut-il devenir un aigle ou un éléphant ? Non. Le hasard, une étape à la fois, ne crée pas d'ailes ou de défenses fonctionnelles là où aucun code génétique le permettant n'était présent auparavant. 

Que peut devenir un poisson ? Un autre poisson. 

Que ne peut pas devenir un poisson ? Un aigle, un éléphant, une fourmi, un être humain, un palmier, ou tout ce qui n'est pas vraiment un poisson. 

Nous pourrions dire que la micro-évolution fonctionne et que la macro-évolution ne fonctionne pas. 

Pour résumer rapidement les différentes problématiques du darwinisme : 

  • L'origine de la vie est inexplicable (plus d'informations à ce sujet dans la 3e partie).
  • Un code sophistiqué, fonctionnel et complexe ne peut pas survenir accidentellement.
  • Les processus aléatoires ne sont pas créatifs.
  • La plupart des mutations ont peu ou pas d'impact sur la survie, mais dégradent le code.
  • La sélection naturelle est impuissante dans la plupart des cas.
  • La complexité irréductible - ou toute autre complexité décente - ne peut être surmontée par la mutation aléatoire associée à la sélection naturelle.
  • Les mutations délétères surpassent les mutations bénéfiques à des milliers contre une.
  • La chronique fossile ne soutient pas le modèle darwiniste.
  • Les observations et les expériences n'ont montré qu'une adaptation très simple et des gènes endommagés.
  • Les mutations induites par les radiations n'entraînent pas d'amélioration, seulement des dommages.
  • La similitude de la structure n'est pas une preuve de l'évolution.
  • Beaucoup des « preuves » de l'évolution sont connues pour être fausses, mais continuent d'être présentées comme vraies.L'idée qu'avec suffisamment de temps tout est possible, est une erreur. Comment en sommes-nous arrivés à une théorie du consensus qui semble à ce point erronée ? Je ne blâme pas Darwin. Je pense qu'il a fait du bon travail avec les outils dont il disposait. Je pense que le problème est venu avec un groupe d'individus qui, constatant que cette théorie faisait la promotion d'une vision matérialiste du monde qu'ils avaient déjà, ont décidé de la promouvoir, de façon un peu trop agressive. Au moment où la science a commencé à exposer les problèmes inhérents à cette théorie, ces individus avaient beaucoup investi pour entretenir le mythe. La théorie de l'évolution est passée de la science à un dogme utilisé pour soutenir l'idéologie du matérialisme et de l'athéisme. Je m'en fiche si les gens veulent être matérialistes et athées, mais quand ils utilisent leurs opinions pour déformer la science et obscurcir la vérité, cela me pose un problème. Ce dogme nous a fait reculer de plusieurs décennies, et peut-être plus si la trajectoire n'est pas corrigée bientôt. 
Comme l'a montré la science depuis environ un demi-siècle, la combinaison mutation aléatoire + sélection naturelle a un champ d'application très limité, et quelque chose d'autre doit donc rendre compte de toute la complexité de la vie qui se manifeste autour de nous. 

Si les théories créationniste et darwiniste n'ont pas les réponses, alors vers quoi se tourner ? 

Le créationnisme est un conte de fées soutenu par un livre douteux, et le darwinisme est une science zombie pleine d'illusions qui s'efforce de garder en vie ce qui est mort depuis longtemps. Comment expliquer alors cette vie foisonnante autour de nous ? C'est là que nous entrons dans un domaine plus spéculatif. Vous êtes libre de tirer vos propres conclusions, mais je vais vous faire part de quelques suggestions qui pourraient valoir la peine d'être considérées. 

L'évolution pourrait se produire - au moins dans une certaine mesure - par d'autres moyens que la mutation aléatoire. Il s'avère que c'est une des suggestions que propose Perry Marshall dans son livre Evolution 2.0. Voici une partie de son résumé : 
  • Le néo-darwinisme prétend que mutation aléatoire + sélection naturelle + Temps = Évolution.
  • La mutation aléatoire est une perturbation et les perturbations sont dommageables.
  • Les cellules réarrangent l'ADN selon des règles précises (transposition).
  • Les cellules échangent de l'ADN avec d'autres cellules (transfert génétique horizontal).
  • Les cellules communiquent entre elles et éditent leurs propres génomes avec un langage incroyablement sophistiqué.
  • Les cellules activent et désactivent le code pour elles-mêmes et leur progéniture (épigénétique).
  • Les cellules fusionnent et coopèrent (symbiogenèse).
Espèce 1 + espèce 2 = nouvelles espèces (hybridation). Nous savons que les organismes s'adaptent rapidement parce que les scientifiques produisent chaque jour de nouvelles espèces en laboratoire.
Mutation adaptative + sélection naturelle + Temps = Évolution 2.0. Tous ces paramètres, de la transposition à l'hybridation, sont des processus qui élargissent l'information contenue dans le code génétique. Ils ne sont pas tout à fait aléatoires, ils affichent des signes d'intelligence ou de dessein et produisent des résultats plus avantageux que la mutation aléatoire. Ils sont notoires depuis plusieurs décennies mais même si (ou parce que ?) ces processus fournissent quelque chose de plus significatif que le hasard, les darwinistes tendent à les ignorer. L'ouvrage de Marshall les explique tous en détail. Je n'en parlerai pas ici, mais il est clair qu'il s'agit de processus évolutifs comportant plus d'avantages qu'aucune circonstance fortuite ne pourra jamais ambitionner atteindre. Pour établir une distinction avec la mutation aléatoire, la somme de ces processus est nommée mutation adaptative par Marshall.Les darwinistes s'en tiennent obstinément à leur idée que « le hasard améliore les choses et crée de l'ordre ». Ils n'aiment pas Dieu, et apparemment ils n'aiment aucune forme d'intelligence non plus. Marshall donne un exemple de cette esquive : « En 2009, le célèbre athée Richard Dawkins a publié son épais best-seller Le plus grand spectacle du monde. Il y affirme que l'évolution est déterminée par des changements aléatoires dans les gènes. Il est intéressant de noter que dans l'ensemble des 450 pages que constitue Le plus grand spectacle du monde...

La symbiogenèse n'est jamais mentionnée.
Le transfert horizontal de gènes est brièvement abordé une fois, minimisé et présenté comme un transfert d'une espèce à l'autre n'existant qu'en de très rares occasions.

L'épigénétique reçoit une petite note de bas de page au chapitre huit. Il s'en détourne avec désinvolture en la considérant comme un « modeste mot à la mode » et une « théorie confuse qui jouira de quinze minutes de gloire ». (Au moment d'écrire ces lignes, l'« épigénétique » est l'un des principaux domaines de la génomique et apparaît 129 000 fois dans Google Scholar [service de Google permettant la recherche d'articles scientifiques - NdT]. Le nombre d'occurrences a doublé au cours des deux dernières années - il s'agit clairement d'un domaine de recherche captivant.)

La transposition n'est jamais mentionnée.
La duplication des génomes n'est jamais mentionnée. Pourquoi Dawkins n'a-t-il pas accordé jusqu'à trois pages aux cinq mécanismes d'évolution les mieux documentés ? Pourquoi se comporte-t-il comme si les cinquante dernières années de microbiologie et les milliards de dollars de recherche n'avaient jamais existé ? L'ancien « Professeur de compréhension des sciences par le grand public » de l'université d'Oxford a écrit l'un des ouvrages sur l'évolution les plus populaires de la dernière décennie, qui a bénéficié d'impressionnantes couvertures médiatiques et pour lequel il a reçu de larges avances financières. 

Alors pourquoi ne mentionne-t-il rien de tout cela ? » Parce que Dawkins a son propre agenda et qu'après toutes ces années il est peu susceptible d'en changer. Son livre était censé démontrer la véracité de l'évolution. Mais tout du long, il mentionne simplement quelques faits et les explique avec la théorie de l'évolution plutôt que d'expliquer la théorie de l'évolution avec quelques faits. Je ne pense pas qu'il comprenne grand-chose aux faits, aux preuves ou à l'objectivité. En raison de toutes les idées fausses qu'il avance dans ses ouvrages, les lire risque d'empirer la connaissance de la vie et de la biologie que l'on pourrait avoir. 

Toutefois, je ne sais pas ce que la théorie de l'évolution 2.0 peut vraiment expliquer. Je ne pense pas que cela puisse nous faire passer du poisson au tigre, et je ne crois pas un seul instant qu'elle ait pu générer l'explosion cambrienne. La raison en est simple : s'il s'agit d'un élément que les organismes ont toujours eu à leur disposition, l'utiliser mille fois plus lors d'une période spécifique et relativement courte que durant toutes les autres époques ne semble pas avoir de cause explicable. C'est aussi la raison pour laquelle les mutations aléatoires seraient tout aussi impuissantes à expliquer l'explosion cambrienne - même si elles fonctionnaient décemment, ce qu'elles ne font pas. En fait, il semble qu'aucun processus naturel puisse expliquer l'explosion cambrienne. La perception du saut dans l'évolution y est tellement phénoménale qu'il semble improbable que les conditions puissent changer si radicalement que la vie soit soudainement en mesure d'évoluer d'elle-même à un rythme plus rapide que jamais de plusieurs ordres de grandeur. 

Il m'apparaît plutôt qu'il a été décidé d'intensifier l'expérience de la « vie sur Terre ». Mais avant d'en arriver là, un autre problème significatif se pose. 

L'origine de la Vie 
L'origine de la vie ne préoccupait pas Darwin. Il est simplement parti du principe que la vie avait commencé d'une manière ou d'une autre et son intérêt portait spécifiquement sur la façon dont elle avait évolué à partir de là. Au XXe siècle, les néo-darwinistes se devaient bien sûr d'améliorer la théorie darwinienne pour être un tant soit peu pris au sérieux, mais cette ambition leur a glissé entre les doigts. Si l'on veut savoir ce qu'il s'est produit « au début » et que l'on consulte la littérature appropriée, le résultat s'avère frustrant parce qu'il n'y a aucune réponse. De nombreuses spéculations dont beaucoup sont assez stupides, mais rien de précis. 

On peut y découvrir des affirmations comme « la transition d'entités non vivantes à des entités vivantes n'a pas été un événement unique mais un processus graduel d'une complexité croissante ». En quoi cela a-t-il un sens ? Comment fait-on pour passer progressivement de la non-vie à la vie ? Quelles sont les étapes intermédiaires ? Des organismes qui ne sont pas morts mais pas tout à fait vivants non plus ? Des zombies ? Autant se battre contre des moulins à vent. En fin de compte, après avoir lu de nombreuses tentatives infructueuses pour expliquer comment la vie a émergé de la non-vie, on constate que la seule vraie réponse est que personne n'en a tout simplement la moindre idée. Quiconque vous dit savoir comment la vie s'est manifestée à partir de la matière morte - ou plutôt, « rien » - vous ment ou s'illusionne. 

Il y a la tristement célèbre expérience Miller-Urey qui fut en son temps saluée comme un grand progrès parce qu'on pensait qu'elle démontrait l'apparition spontanée dans la Nature de certains acides aminés. Cette expérience fut aussi présentée comme la preuve de la création des « éléments constitutifs de la vie », expression problématique parce que fallacieuse. Les acides aminés construisent des protéines, et celles-ci sont essentielles au sein des organismes vivants. Toutefois, obtenir quelques acides aminés et prétendre avoir pour ainsi dire créé la vie revient à griffonner quelques symboles aléatoires sur un morceau de papier et se flatter d'avoir quasiment conçu un langage. On est loin de produire quoique ce soit qui s'apparente de près ou de loin à la vie juste avec quelques acides aminés. Tout comme lorsqu'on a « si », « alors » et « autrement » ne revient pas à posséder un programme informatique, même si ces trois mots peuvent être considérés comme les éléments constitutifs d'un code logiciel. Et même si les bons acides aminés se sont assemblés en grand nombre et dans le bon ordre pour former une protéine - ce qui s'avère pure fantaisie -, alors quoi ? On a une protéine, mais sans une cellule pleinement fonctionnelle, que peut-elle faire ? Absolument rien. 

La bactérie est prétendument la première forme de vie. Pour se reproduire, les bactéries ont besoin d'ADN, de différentes versions d'ARN, de certaines enzymes, de ribosomes, etc. Tout ces composants sont beaucoup trop complexes pour être assemblés lors d'une circonstance fortuite. L'ADN lui-même est trop complexe pour être combiné de façon hasardeuse - peu importe le temps que cela prend - sans omettre le fait que les autres composants demeurent nécessaires à son fonctionnement. L'ADN est un code plus sophistiqué que tout ce que nous avons jamais conçu, et il n'y a absolument aucune chance qu'il soit le fruit d'une circonstance fortuite. Nous ne connaissons qu'un seul moyen de créer un code : que sa conception émane d'un esprit intelligent. 

Voici le commentaire de Marshall à ce sujet : « Origine de la vie : La théorie de l'information révèle que les codes exigent un concepteur ou un processus naturel non découvert qui génère des codes ». Si vous découvrez un processus naturel qui génère des codes, vous pouvez gagner cinq millions de dollars US [le montant des gains s'élèvent à dix millions de dollars US depuis le 31 mai 2019 - NdT]. Oui, c'est quelque chose que Marshall offre, et ce depuis un certain temps [août 2017 - NdT]. Vous pouvez suivre ce lien pour lire le règlement du concours. Si vous découvrez comment l'ADN a pu se manifester spontanément, vous deviendrez riche et le darwinisme aura peut-être une chance de survivre à son évolution. Personne n'a encore à l'évidence réclamé le prix, et il est peu probable que qui que ce soit le réclame puisque les codes exigent vraiment un concepteur, parce que c'est ainsi que tous les codes que nous connaissons ont été créés. 

L'ADN est une base de données - de manuels d'instruction à l'usage des structures et des processus complexes - dont l'immensité est incompréhensible... Qu'un système moléculaire aussi sophistiqué que l'ADN ait été conçu est une évidence. Personne n'a été en mesure d'offrir une alternative plausible. Les darwinistes font - désespérément - de gros efforts mais restent enlisés dans « nous n'en avons pas la moindre idée » ou insistent stupidement sur le fait que c'était un accident. Comme je l'ai mentionné, une cellule en mesure de se reproduire doit être bien plus complexe que l'ADN lui-même. Ce genre de complexité exige une conception. Certaines personnes assimilent le dessein intelligent à Dieu, parce qu'apparemment elles manquent à la fois d'imagination et de bon sens. Une voiture est le produit d'un dessein intelligent. Internet est le produit d'un dessein intelligent. Ont-ils été conçus par Dieu ? Alors pourquoi irait-on s'imaginer qu'un dessein intelligent signifie Dieu ? Je ne suis pas sûre de savoir quelle partie des mots « intelligent » ou « dessein » s'apparente à « Dieu ». 

Les propriétés mêmes de l'ADN nous signalent qu'il est très probablement le produit d'un dessein, et que son concepteur a dû être bien plus intelligent que nous. Qui cela peut-il être, alors ? Qui qu'ils soient, ils ne sont clairement pas là pour nous donner une chance de discuter avec eux. Mais voyons les choses sous un autre angle. Nous interférons nous-mêmes avec l'ingénierie génétique depuis un certain temps et peu de chose nous empêche de semer de la vie sur une autre planète - si nous en trouvons une où les conditions sont favorables. Donc, d'un point de vue logistique, il n'y a aucune raison pour que la vie sur Terre n'ait pas été semée par quelque être qui nous soit semblable. C'est bien plus plausible que la magie créationniste de « Dieu a tout créé » et la magie darwiniste de « MDR tout arrive juste par hasard ». 

Mais si nous devions semer la vie ailleurs, nous serions dans l'obligation d'utiliser l'ADN terrestre, parce que nous sommes loin d'être en mesure de vraiment créer une nouvelle vie. Pensez-y ; malgré toutes nos connaissances et notre intelligence et même si nous avons une compréhension basique du fonctionnement de l'ADN, nous ne sommes toujours pas en mesure de concevoir un code pour créer la vie. Et malgré cela, les darwinistes croient que la vie se crée toute seule, par une « circonstance fortuite ». Mais si quelqu'un avait semé la vie sur Terre, il aurait probablement été constitué de la même structure d'ADN que celle utilisée, ce qui ne fait que déplacer la question des « premières origines » sur « eux » et n'explique pas l'origine de l'ADN, mais expliquerait la vie sur Terre. 

Quoi qu'il en soit et quel qu'en soit le responsable, il est manifeste que le code immensément sophistiqué de la vie sur Terre est le produit d'une conception intelligente quelle qu'elle soit. Cette conclusion inévitable n'est pas moins valable sous prétexte que nous ne sommes pas encore en mesure de connaître le concepteur. Et il n'y a aucune raison de s'en remettre à Dieu pour la réponse. Pour être impartial, il n'est pas plus irraisonnable de penser qu'une entité que nous appellerions Dieu ait pu créer la Vie initialement. Il n'y a peut-être aucune preuve à l'appui mais il n'y a pas plus de preuves contre - du moins en théorie. Et rappelez-vous, le darwinisme est une théorie ! 

Au fur et à mesure que l'on s'habitue à l'idée que le concepteur n'a pas besoin d'être Dieu, il devrait être plus facile de comprendre toute éventuelle imperfection dans la conception. Si nous semions la vie sur une autre planète, je suis sûr qu'il y aurait beaucoup d'erreurs. Dawkins se moque régulièrement dans ses ouvrages de la théorie du dessein intelligent avec des questions telles que « qui, avec un esprit sain, concevrait ceci ? » et « pourquoi un concepteur intelligent l'élaborerait-il de cette façon ? ». Dawkins estime connaître si parfaitement la biologie de toutes les créatures qu'il sait comment tout organisme fonctionne et a fonctionné dans le passé, et il concevrait tellement mieux les choses qu'il s'arroge le droit de juger ce qui est bon et ce qui ne l'est pas. Dawkins a vraisemblablement scruté de près les millions de produits absolument parfaits et sans défauts que les êtres humains ont conçu puisqu'il sait également que la conception se doit d'être parfaite. 

La dernière chose que je veux mentionner ici est la conscience. Enfant du matérialisme, le darwinisme écarte la conscience comme s'il s'agissait d'une sorte d'effet secondaire. C'est, à mon avis, l'une des plus grosses erreurs jamais commises en science. Si l'on écarte la moitié de l'Univers de nos équations, comment s'attendre à ce que le résultat ait un sens ? C'est d'autant plus embarrassant que nous savons depuis longtemps grâce à la mécanique quantique que l'esprit peut affecter la matière. La question que l'on devrait probablement se poser est donc la suivante : la conscience pourrait-elle affecter l'ADN d'une manière quelconque ? Par exemple, certains états mentaux ou émotionnels prolongés pourraient-ils activer et désactiver les gènes ? Peut-il y avoir une sorte d'accordage entre le corps et l'esprit ? 

À l'évidence, nous ne savons rien avec certitude dans ce domaine - la faute au matérialisme qui sous-tend la science moderne - puisque personne n'effectue ce type de recherche, mais beaucoup considèrent qu'il s'agit d'un axe d'investigation légitime. Le matérialisme ne peut pas expliquer l'ADN et la vie, et le darwinisme ne peut pas expliquer l'évolution, alors réfléchir au rôle que la conscience serait susceptible de jouer pourrait en valoir la peine. Et si la conscience y a un rôle, il n'est probablement pas aléatoire et doit certainement rendre compte d'un concept plus constructif que les mutations aléatoires. Si le créationnisme et le darwinisme/matérialisme ne parviennent pas à décrire la réalité, la réponse essentielle est d'explorer d'autres options avec un esprit ouvert. 

Alors bien sûr, si l'on pense que le matérialisme est un fait avéré, que tout est matière et que la conscience n'est qu'une illusion, on ne peut pas adhérer à ces idées, ce qui revient à avouer être un robot biologique génétiquement programmé, sans libre arbitre, sans but, sans valeurs, un être pour qui la vie n'a finalement aucun sens. Il est vain de débattre de quoi que ce soit avec de telles personnes car toute discussion ne peut qu'être l'inévitable résultat prédéterminé et sans signification de nos gènes. (Oui, le matérialisme est à ce point stupide qu'il est inutile de perdre plus de temps là-dessus.) 

Le tableau d'ensemble 

Comment tous ces éléments s'imbriquent-ils ? 
L'ADN a dû être conçu. Je suis disposé à explorer d'autres options, mais à moins que quelqu'un ne gagne ces dix millions de dollars US pour avoir découvert comment le code le plus sophistiqué qu'il nous est donné de connaître a pu s'auto-assembler accidentellement, le dessein intelligent est la seule réponse qui ait un sens selon moi. S'il existe un concepteur, il est raisonnable de supposer que la vie sur Terre est venue de l'extérieur. Puis la mutation aléatoire et la sélection naturelle lui ont succédé et la vie a modestement entrepris de s'adapter et de se diversifier. Gardez à l'esprit que rien de complexe n'a « évolué » depuis deux milliards d'années. Cette époque est en fait conforme au darwinisme. 

Je pense que lors de l'explosion cambrienne « quelqu'un, quelqu'être » a dû ajouter plus - bien plus - de formes de vie parce qu'il n'existe à notre connaissance aucun processus naturel en mesure d'expliquer rationnellement ce type de saut quantique. La « circonstance fortuite » n'est pas une explication sérieuse. De telles interventions se sont probablement répétées à maintes reprises et les périodes subséquentes aux catastrophes de grande ampleur et aux phénomènes d'extinction sont de bons candidats. 

En dehors d'un nombre méconnu de telles interventions, la vie sur Terre est laissée à elle-même. Cela signifie que le processus darwiniste de mutation aléatoire associée à la sélection naturelle représente une partie de l'adaptation, que la mutation adaptative décrite dans Evolution 2.0 peut en représenter d'autres, et si la conscience joue un rôle - ce qui est difficile à savoir à cause de l'attention minimale que lui accordent les scientifiques - alors la conscience peut aussi être responsable d'une forme d'évolution, voire potentiellement plus que les autres mécanismes. 

Tout au long de la majeure partie de l'histoire de la vie terrestre, ces processus naturels étaient seuls au monde. En ce qui concerne tous les « chaînons manquants » et les apparents sauts quantiques, une forme d'intervention intelligente extérieure semble être l'explication la plus probable, car nous n'avons aucune alternative scientifiquement plausible. En fin de compte, la complexité fonctionnelle ne se produit pas sans une certaine intelligence pour l'appuyer. 

Nous n'avons certainement pas toutes les réponses et nous n'en trouverons peut-être pas dans un proche avenir, mais nous pouvons aller de l'avant, dans la bonne direction, en rejetant les idées qui contredisent la science. Les changements aléatoires n'améliorent pas la fonctionnalité. L'idéologie n'est pas la science. 

******************************* 

Littérature recommandée 
Michael J. Behe - Darwin's Black Box (1996) - La boîte noire de Darwin (2009 pour la version française) 
Michael J. Behe - The Edge of Evolution (2008) 
Michael J. Behe - Darwin Devolves (2019) 
Jonathan Wells - Icons of Evolution (2002) 
Perry Marshall - Evolution 2.0 (2015) 
John Sanford - Genetic Entropy & the Mystery of the Genome (2005) 




0 commentaires:

Enregistrer un commentaire

 
Top